Review




Structured Review

Addgene inc alix-bro1
Alix Bro1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/alix-bro1/hd+ptp+bro1++1+361+/pm37450591-341-0-7
Average 90 stars, based on 1 article reviews
alix-bro1 - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

other:

Article Title: Reversible phase separation of ESCRT protein ALIX through tyrosine phosphorylation.
Article Snippet: ALIX-Bro1 and PTP1B were obtained from the Addgene repository, accession nos.



Similar Products

90
Azenta alix mutants oligonucleotide: fl/bro1 sense 5’- ggggacaagtttgtacaaaaaagcaggcttcgcgacattcatctcggtgcagctg-3’
Alix Mutants Oligonucleotide: Fl/Bro1 Sense 5’ Ggggacaagtttgtacaaaaaagcaggcttcgcgacattcatctcggtgcagctg 3’, supplied by Azenta, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/alix-bro1/alix+mutants+oligonucleotide++fl+bro1+sense+5%E2%80%99++ggggacaagtttgtacaaaaaagcaggcttcgcgacattcatctcggtgcagctg+3%E2%80%99/pm39533058-284-195-190
Average 90 stars, based on 1 article reviews
alix mutants oligonucleotide: fl/bro1 sense 5’- ggggacaagtttgtacaaaaaagcaggcttcgcgacattcatctcggtgcagctg-3’ - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Addgene inc alix-bro1
Alix Bro1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/alix-bro1/hd+ptp+bro1++1+361+/pm37450591-341-0-7
Average 90 stars, based on 1 article reviews
alix-bro1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

91
Addgene inc addgene repository
Addgene Repository, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/alix-bro1/pet16b+ALIX+Bro1+(1-359)+(Plasmid+%2380641)/pmc10348681__sciadv__adg3913_sm-35-8-8
Average 91 stars, based on 1 article reviews
addgene repository - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

91
Addgene inc v 702
V 702, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/alix-bro1/pet16b+ALIX+Bro1+(1-359)+(Plasmid+%2380641)/elias_ruben_d__2023__structural_and_mechanistic_studies_of_the_proline_rich_domain_of_alix-1366-22-21
Average 91 stars, based on 1 article reviews
v 702 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

91
Addgene inc accession no 80641
Accession No 80641, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/alix-bro1/pet16b+ALIX+Bro1+(1-359)+(Plasmid+%2380641)/pmc08577116-234-22-21
Average 91 stars, based on 1 article reviews
accession no 80641 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

90
Agilent technologies gst-alix bro1 cdna plasmid
A YPX 3 L motif of PAR1 mediates binding to <t>ALIX.</t> (A) Alignment of PAR1 and PAR2 ICL2 sequences from various species. The conserved residues of the YPX 3 L motif are shaded in gray. (B) HeLa cells coexpressing HA-ALIX WT and either FLAG-PAR1 WT or Y206A mutant were stimulated with 100 µM SFLLRN at 37°C, as indicated. Cell lysates were immunoprecipitated and examined as described in . IB, immunoblotting. The data (mean ± SD) represent the amount of immunoprecipitated ALIX normalized to the amount of immunoprecipitated PAR1 and were significant, as determined by Student’s t test (**, P < 0.01; n = 3). A.U., arbitrary unit. (C) HeLa cells transfected with FLAG-PAR1 and either HA-ALIX WT or F676D mutant were stimulated with agonist and processed as previously described. Cell lysates were immunoblotted with anti-HA and -actin antibodies. The data (mean ± SD) were calculated, as previously described, and significant, as determined by Student’s t test (**, P < 0.01; n = 3). (D) Biotinylated PAR1 ICL2 peptide containing the YPX 3 L motif was immobilized on streptavidin beads and incubated with <t>GST,</t> GST–ALIX V domain, GST–ALIX V F676D, or the GST–ALIX <t>Bro1</t> domain. Pulldowns (PD) were analyzed for the presence of bound protein by immunoblotting. Input was analyzed by Coomassie staining.
Gst Alix Bro1 Cdna Plasmid, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/alix-bro1/pmc03341166-268-8-20
Average 90 stars, based on 1 article reviews
gst-alix bro1 cdna plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


A YPX 3 L motif of PAR1 mediates binding to ALIX. (A) Alignment of PAR1 and PAR2 ICL2 sequences from various species. The conserved residues of the YPX 3 L motif are shaded in gray. (B) HeLa cells coexpressing HA-ALIX WT and either FLAG-PAR1 WT or Y206A mutant were stimulated with 100 µM SFLLRN at 37°C, as indicated. Cell lysates were immunoprecipitated and examined as described in . IB, immunoblotting. The data (mean ± SD) represent the amount of immunoprecipitated ALIX normalized to the amount of immunoprecipitated PAR1 and were significant, as determined by Student’s t test (**, P < 0.01; n = 3). A.U., arbitrary unit. (C) HeLa cells transfected with FLAG-PAR1 and either HA-ALIX WT or F676D mutant were stimulated with agonist and processed as previously described. Cell lysates were immunoblotted with anti-HA and -actin antibodies. The data (mean ± SD) were calculated, as previously described, and significant, as determined by Student’s t test (**, P < 0.01; n = 3). (D) Biotinylated PAR1 ICL2 peptide containing the YPX 3 L motif was immobilized on streptavidin beads and incubated with GST, GST–ALIX V domain, GST–ALIX V F676D, or the GST–ALIX Bro1 domain. Pulldowns (PD) were analyzed for the presence of bound protein by immunoblotting. Input was analyzed by Coomassie staining.

Journal: The Journal of Cell Biology

Article Title: ALIX binds a YPX 3 L motif of the GPCR PAR1 and mediates ubiquitin-independent ESCRT-III/MVB sorting

doi: 10.1083/jcb.201110031

Figure Lengend Snippet: A YPX 3 L motif of PAR1 mediates binding to ALIX. (A) Alignment of PAR1 and PAR2 ICL2 sequences from various species. The conserved residues of the YPX 3 L motif are shaded in gray. (B) HeLa cells coexpressing HA-ALIX WT and either FLAG-PAR1 WT or Y206A mutant were stimulated with 100 µM SFLLRN at 37°C, as indicated. Cell lysates were immunoprecipitated and examined as described in . IB, immunoblotting. The data (mean ± SD) represent the amount of immunoprecipitated ALIX normalized to the amount of immunoprecipitated PAR1 and were significant, as determined by Student’s t test (**, P < 0.01; n = 3). A.U., arbitrary unit. (C) HeLa cells transfected with FLAG-PAR1 and either HA-ALIX WT or F676D mutant were stimulated with agonist and processed as previously described. Cell lysates were immunoblotted with anti-HA and -actin antibodies. The data (mean ± SD) were calculated, as previously described, and significant, as determined by Student’s t test (**, P < 0.01; n = 3). (D) Biotinylated PAR1 ICL2 peptide containing the YPX 3 L motif was immobilized on streptavidin beads and incubated with GST, GST–ALIX V domain, GST–ALIX V F676D, or the GST–ALIX Bro1 domain. Pulldowns (PD) were analyzed for the presence of bound protein by immunoblotting. Input was analyzed by Coomassie staining.

Article Snippet: GST vector, GST–ALIX V, GST–ALIX V F676D, and GST-ALIX Bro1 cDNA plasmids were transformed into BL21 (DE3) Escherichia coli cells (Agilent Technologies).

Techniques: Binding Assay, Mutagenesis, Immunoprecipitation, Western Blot, Transfection, Incubation, Staining